Mass Spectrometry:Article Title: Small-molecule enhancement of METTL3 S-palmitoylation as a therapeutic strategy for osteoarthritis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Mass Spectrometry This study Tables S1, S2, S3 and S4 Experimental models: Cell lines HEK293T Wang et al. 11 ATCC Cat#CRL-3216; RRID: CVCL_0063 BECN1-KO HEK293T Wang et al. 11 N/A ATG5-KO HEK293T Wang et al. 11 N/A Human embryonic stem cells (hESCs) ATCC Cat# SCRC-2002; RRID: CVCL_9727 Experimental models: Organisms/strains C57BL/6 Mettl3 C376S mice GerPharmatech N/A C57BL/6 Zdhhc24 − /− mice GerPharmatech N/A Oligonucleotides See Table S5 for siRNA sequences This study N/A See Table S6 for qRT-PCR primers This study N/A Recombinant DNA Flag-METTL3 and constructs This study N/A HA-METTL3 and constructs This study N/A Flag-ZDHHC24 and constructs This study N/A HA-ZDHHC24 and constructs This study N/A Flag-ABHD17A and constructs This study N/A HA-ABHD17A and constructs This study N/A HA-APT1 This study N/A HA-APT2 This study N/A HA-ABHD17B This study N/A HA-ABHD17C This study N/A Flag-ZDHHCs This study N/A Flag-HSC70 This study N/A Flag-LAMP2A This study N/A Software and algorithms GraphPad Prism GraphPad Software https://www.graphpad.com/ Image Lab Bio-Rad Laboratories, inc. http://www.bio-rad.com/zhcn/product/image-lab- software ImageJ GNU General Public License https://imagej.net/software/fiji/ ZEN software Carl Zeiss https://www.zeiss.com.cn/microscopy/products/ microscope-software/zen.html 20 Cell Reports 45, 116993, March 24, 2026 the resultant mice, and the presence of the mutation was verified through PCR amplification using specific primers: METTL3-F (GAGCTTGCTCTTACACAGAGTGTTG) and METTL3-R (CACTCTGCTGTATTTCCCATACC). ..
Quantitative RT-PCR:Article Title: Small-molecule enhancement of METTL3 S-palmitoylation as a therapeutic strategy for osteoarthritis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Mass Spectrometry This study Tables S1, S2, S3 and S4 Experimental models: Cell lines HEK293T Wang et al. 11 ATCC Cat#CRL-3216; RRID: CVCL_0063 BECN1-KO HEK293T Wang et al. 11 N/A ATG5-KO HEK293T Wang et al. 11 N/A Human embryonic stem cells (hESCs) ATCC Cat# SCRC-2002; RRID: CVCL_9727 Experimental models: Organisms/strains C57BL/6 Mettl3 C376S mice GerPharmatech N/A C57BL/6 Zdhhc24 − /− mice GerPharmatech N/A Oligonucleotides See Table S5 for siRNA sequences This study N/A See Table S6 for qRT-PCR primers This study N/A Recombinant DNA Flag-METTL3 and constructs This study N/A HA-METTL3 and constructs This study N/A Flag-ZDHHC24 and constructs This study N/A HA-ZDHHC24 and constructs This study N/A Flag-ABHD17A and constructs This study N/A HA-ABHD17A and constructs This study N/A HA-APT1 This study N/A HA-APT2 This study N/A HA-ABHD17B This study N/A HA-ABHD17C This study N/A Flag-ZDHHCs This study N/A Flag-HSC70 This study N/A Flag-LAMP2A This study N/A Software and algorithms GraphPad Prism GraphPad Software https://www.graphpad.com/ Image Lab Bio-Rad Laboratories, inc. http://www.bio-rad.com/zhcn/product/image-lab- software ImageJ GNU General Public License https://imagej.net/software/fiji/ ZEN software Carl Zeiss https://www.zeiss.com.cn/microscopy/products/ microscope-software/zen.html 20 Cell Reports 45, 116993, March 24, 2026 the resultant mice, and the presence of the mutation was verified through PCR amplification using specific primers: METTL3-F (GAGCTTGCTCTTACACAGAGTGTTG) and METTL3-R (CACTCTGCTGTATTTCCCATACC). ..
Recombinant:Article Title: Small-molecule enhancement of METTL3 S-palmitoylation as a therapeutic strategy for osteoarthritis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Mass Spectrometry This study Tables S1, S2, S3 and S4 Experimental models: Cell lines HEK293T Wang et al. 11 ATCC Cat#CRL-3216; RRID: CVCL_0063 BECN1-KO HEK293T Wang et al. 11 N/A ATG5-KO HEK293T Wang et al. 11 N/A Human embryonic stem cells (hESCs) ATCC Cat# SCRC-2002; RRID: CVCL_9727 Experimental models: Organisms/strains C57BL/6 Mettl3 C376S mice GerPharmatech N/A C57BL/6 Zdhhc24 − /− mice GerPharmatech N/A Oligonucleotides See Table S5 for siRNA sequences This study N/A See Table S6 for qRT-PCR primers This study N/A Recombinant DNA Flag-METTL3 and constructs This study N/A HA-METTL3 and constructs This study N/A Flag-ZDHHC24 and constructs This study N/A HA-ZDHHC24 and constructs This study N/A Flag-ABHD17A and constructs This study N/A HA-ABHD17A and constructs This study N/A HA-APT1 This study N/A HA-APT2 This study N/A HA-ABHD17B This study N/A HA-ABHD17C This study N/A Flag-ZDHHCs This study N/A Flag-HSC70 This study N/A Flag-LAMP2A This study N/A Software and algorithms GraphPad Prism GraphPad Software https://www.graphpad.com/ Image Lab Bio-Rad Laboratories, inc. http://www.bio-rad.com/zhcn/product/image-lab- software ImageJ GNU General Public License https://imagej.net/software/fiji/ ZEN software Carl Zeiss https://www.zeiss.com.cn/microscopy/products/ microscope-software/zen.html 20 Cell Reports 45, 116993, March 24, 2026 the resultant mice, and the presence of the mutation was verified through PCR amplification using specific primers: METTL3-F (GAGCTTGCTCTTACACAGAGTGTTG) and METTL3-R (CACTCTGCTGTATTTCCCATACC). ..
Construct:Article Title: Small-molecule enhancement of METTL3 S-palmitoylation as a therapeutic strategy for osteoarthritis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Mass Spectrometry This study Tables S1, S2, S3 and S4 Experimental models: Cell lines HEK293T Wang et al. 11 ATCC Cat#CRL-3216; RRID: CVCL_0063 BECN1-KO HEK293T Wang et al. 11 N/A ATG5-KO HEK293T Wang et al. 11 N/A Human embryonic stem cells (hESCs) ATCC Cat# SCRC-2002; RRID: CVCL_9727 Experimental models: Organisms/strains C57BL/6 Mettl3 C376S mice GerPharmatech N/A C57BL/6 Zdhhc24 − /− mice GerPharmatech N/A Oligonucleotides See Table S5 for siRNA sequences This study N/A See Table S6 for qRT-PCR primers This study N/A Recombinant DNA Flag-METTL3 and constructs This study N/A HA-METTL3 and constructs This study N/A Flag-ZDHHC24 and constructs This study N/A HA-ZDHHC24 and constructs This study N/A Flag-ABHD17A and constructs This study N/A HA-ABHD17A and constructs This study N/A HA-APT1 This study N/A HA-APT2 This study N/A HA-ABHD17B This study N/A HA-ABHD17C This study N/A Flag-ZDHHCs This study N/A Flag-HSC70 This study N/A Flag-LAMP2A This study N/A Software and algorithms GraphPad Prism GraphPad Software https://www.graphpad.com/ Image Lab Bio-Rad Laboratories, inc. http://www.bio-rad.com/zhcn/product/image-lab- software ImageJ GNU General Public License https://imagej.net/software/fiji/ ZEN software Carl Zeiss https://www.zeiss.com.cn/microscopy/products/ microscope-software/zen.html 20 Cell Reports 45, 116993, March 24, 2026 the resultant mice, and the presence of the mutation was verified through PCR amplification using specific primers: METTL3-F (GAGCTTGCTCTTACACAGAGTGTTG) and METTL3-R (CACTCTGCTGTATTTCCCATACC). ..
Software:Article Title: Small-molecule enhancement of METTL3 S-palmitoylation as a therapeutic strategy for osteoarthritis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Mass Spectrometry This study Tables S1, S2, S3 and S4 Experimental models: Cell lines HEK293T Wang et al. 11 ATCC Cat#CRL-3216; RRID: CVCL_0063 BECN1-KO HEK293T Wang et al. 11 N/A ATG5-KO HEK293T Wang et al. 11 N/A Human embryonic stem cells (hESCs) ATCC Cat# SCRC-2002; RRID: CVCL_9727 Experimental models: Organisms/strains C57BL/6 Mettl3 C376S mice GerPharmatech N/A C57BL/6 Zdhhc24 − /− mice GerPharmatech N/A Oligonucleotides See Table S5 for siRNA sequences This study N/A See Table S6 for qRT-PCR primers This study N/A Recombinant DNA Flag-METTL3 and constructs This study N/A HA-METTL3 and constructs This study N/A Flag-ZDHHC24 and constructs This study N/A HA-ZDHHC24 and constructs This study N/A Flag-ABHD17A and constructs This study N/A HA-ABHD17A and constructs This study N/A HA-APT1 This study N/A HA-APT2 This study N/A HA-ABHD17B This study N/A HA-ABHD17C This study N/A Flag-ZDHHCs This study N/A Flag-HSC70 This study N/A Flag-LAMP2A This study N/A Software and algorithms GraphPad Prism GraphPad Software https://www.graphpad.com/ Image Lab Bio-Rad Laboratories, inc. http://www.bio-rad.com/zhcn/product/image-lab- software ImageJ GNU General Public License https://imagej.net/software/fiji/ ZEN software Carl Zeiss https://www.zeiss.com.cn/microscopy/products/ microscope-software/zen.html 20 Cell Reports 45, 116993, March 24, 2026 the resultant mice, and the presence of the mutation was verified through PCR amplification using specific primers: METTL3-F (GAGCTTGCTCTTACACAGAGTGTTG) and METTL3-R (CACTCTGCTGTATTTCCCATACC). ..
Microscopy:Article Title: Small-molecule enhancement of METTL3 S-palmitoylation as a therapeutic strategy for osteoarthritis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Mass Spectrometry This study Tables S1, S2, S3 and S4 Experimental models: Cell lines HEK293T Wang et al. 11 ATCC Cat#CRL-3216; RRID: CVCL_0063 BECN1-KO HEK293T Wang et al. 11 N/A ATG5-KO HEK293T Wang et al. 11 N/A Human embryonic stem cells (hESCs) ATCC Cat# SCRC-2002; RRID: CVCL_9727 Experimental models: Organisms/strains C57BL/6 Mettl3 C376S mice GerPharmatech N/A C57BL/6 Zdhhc24 − /− mice GerPharmatech N/A Oligonucleotides See Table S5 for siRNA sequences This study N/A See Table S6 for qRT-PCR primers This study N/A Recombinant DNA Flag-METTL3 and constructs This study N/A HA-METTL3 and constructs This study N/A Flag-ZDHHC24 and constructs This study N/A HA-ZDHHC24 and constructs This study N/A Flag-ABHD17A and constructs This study N/A HA-ABHD17A and constructs This study N/A HA-APT1 This study N/A HA-APT2 This study N/A HA-ABHD17B This study N/A HA-ABHD17C This study N/A Flag-ZDHHCs This study N/A Flag-HSC70 This study N/A Flag-LAMP2A This study N/A Software and algorithms GraphPad Prism GraphPad Software https://www.graphpad.com/ Image Lab Bio-Rad Laboratories, inc. http://www.bio-rad.com/zhcn/product/image-lab- software ImageJ GNU General Public License https://imagej.net/software/fiji/ ZEN software Carl Zeiss https://www.zeiss.com.cn/microscopy/products/ microscope-software/zen.html 20 Cell Reports 45, 116993, March 24, 2026 the resultant mice, and the presence of the mutation was verified through PCR amplification using specific primers: METTL3-F (GAGCTTGCTCTTACACAGAGTGTTG) and METTL3-R (CACTCTGCTGTATTTCCCATACC). ..
Mutagenesis:Article Title: Small-molecule enhancement of METTL3 S-palmitoylation as a therapeutic strategy for osteoarthritis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Mass Spectrometry This study Tables S1, S2, S3 and S4 Experimental models: Cell lines HEK293T Wang et al. 11 ATCC Cat#CRL-3216; RRID: CVCL_0063 BECN1-KO HEK293T Wang et al. 11 N/A ATG5-KO HEK293T Wang et al. 11 N/A Human embryonic stem cells (hESCs) ATCC Cat# SCRC-2002; RRID: CVCL_9727 Experimental models: Organisms/strains C57BL/6 Mettl3 C376S mice GerPharmatech N/A C57BL/6 Zdhhc24 − /− mice GerPharmatech N/A Oligonucleotides See Table S5 for siRNA sequences This study N/A See Table S6 for qRT-PCR primers This study N/A Recombinant DNA Flag-METTL3 and constructs This study N/A HA-METTL3 and constructs This study N/A Flag-ZDHHC24 and constructs This study N/A HA-ZDHHC24 and constructs This study N/A Flag-ABHD17A and constructs This study N/A HA-ABHD17A and constructs This study N/A HA-APT1 This study N/A HA-APT2 This study N/A HA-ABHD17B This study N/A HA-ABHD17C This study N/A Flag-ZDHHCs This study N/A Flag-HSC70 This study N/A Flag-LAMP2A This study N/A Software and algorithms GraphPad Prism GraphPad Software https://www.graphpad.com/ Image Lab Bio-Rad Laboratories, inc. http://www.bio-rad.com/zhcn/product/image-lab- software ImageJ GNU General Public License https://imagej.net/software/fiji/ ZEN software Carl Zeiss https://www.zeiss.com.cn/microscopy/products/ microscope-software/zen.html 20 Cell Reports 45, 116993, March 24, 2026 the resultant mice, and the presence of the mutation was verified through PCR amplification using specific primers: METTL3-F (GAGCTTGCTCTTACACAGAGTGTTG) and METTL3-R (CACTCTGCTGTATTTCCCATACC). ..
Polymerase Chain Reaction:Article Title: Small-molecule enhancement of METTL3 S-palmitoylation as a therapeutic strategy for osteoarthritis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Mass Spectrometry This study Tables S1, S2, S3 and S4 Experimental models: Cell lines HEK293T Wang et al. 11 ATCC Cat#CRL-3216; RRID: CVCL_0063 BECN1-KO HEK293T Wang et al. 11 N/A ATG5-KO HEK293T Wang et al. 11 N/A Human embryonic stem cells (hESCs) ATCC Cat# SCRC-2002; RRID: CVCL_9727 Experimental models: Organisms/strains C57BL/6 Mettl3 C376S mice GerPharmatech N/A C57BL/6 Zdhhc24 − /− mice GerPharmatech N/A Oligonucleotides See Table S5 for siRNA sequences This study N/A See Table S6 for qRT-PCR primers This study N/A Recombinant DNA Flag-METTL3 and constructs This study N/A HA-METTL3 and constructs This study N/A Flag-ZDHHC24 and constructs This study N/A HA-ZDHHC24 and constructs This study N/A Flag-ABHD17A and constructs This study N/A HA-ABHD17A and constructs This study N/A HA-APT1 This study N/A HA-APT2 This study N/A HA-ABHD17B This study N/A HA-ABHD17C This study N/A Flag-ZDHHCs This study N/A Flag-HSC70 This study N/A Flag-LAMP2A This study N/A Software and algorithms GraphPad Prism GraphPad Software https://www.graphpad.com/ Image Lab Bio-Rad Laboratories, inc. http://www.bio-rad.com/zhcn/product/image-lab- software ImageJ GNU General Public License https://imagej.net/software/fiji/ ZEN software Carl Zeiss https://www.zeiss.com.cn/microscopy/products/ microscope-software/zen.html 20 Cell Reports 45, 116993, March 24, 2026 the resultant mice, and the presence of the mutation was verified through PCR amplification using specific primers: METTL3-F (GAGCTTGCTCTTACACAGAGTGTTG) and METTL3-R (CACTCTGCTGTATTTCCCATACC). ..
Amplification:Article Title: Small-molecule enhancement of METTL3 S-palmitoylation as a therapeutic strategy for osteoarthritis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Mass Spectrometry This study Tables S1, S2, S3 and S4 Experimental models: Cell lines HEK293T Wang et al. 11 ATCC Cat#CRL-3216; RRID: CVCL_0063 BECN1-KO HEK293T Wang et al. 11 N/A ATG5-KO HEK293T Wang et al. 11 N/A Human embryonic stem cells (hESCs) ATCC Cat# SCRC-2002; RRID: CVCL_9727 Experimental models: Organisms/strains C57BL/6 Mettl3 C376S mice GerPharmatech N/A C57BL/6 Zdhhc24 − /− mice GerPharmatech N/A Oligonucleotides See Table S5 for siRNA sequences This study N/A See Table S6 for qRT-PCR primers This study N/A Recombinant DNA Flag-METTL3 and constructs This study N/A HA-METTL3 and constructs This study N/A Flag-ZDHHC24 and constructs This study N/A HA-ZDHHC24 and constructs This study N/A Flag-ABHD17A and constructs This study N/A HA-ABHD17A and constructs This study N/A HA-APT1 This study N/A HA-APT2 This study N/A HA-ABHD17B This study N/A HA-ABHD17C This study N/A Flag-ZDHHCs This study N/A Flag-HSC70 This study N/A Flag-LAMP2A This study N/A Software and algorithms GraphPad Prism GraphPad Software https://www.graphpad.com/ Image Lab Bio-Rad Laboratories, inc. http://www.bio-rad.com/zhcn/product/image-lab- software ImageJ GNU General Public License https://imagej.net/software/fiji/ ZEN software Carl Zeiss https://www.zeiss.com.cn/microscopy/products/ microscope-software/zen.html 20 Cell Reports 45, 116993, March 24, 2026 the resultant mice, and the presence of the mutation was verified through PCR amplification using specific primers: METTL3-F (GAGCTTGCTCTTACACAGAGTGTTG) and METTL3-R (CACTCTGCTGTATTTCCCATACC). ..
|
ATCC is a verified supplier 
ATCC manufactures this product 